Alpaka

[ Pobierz całość w formacie PDF ]
//-->Journal of Immunological Methods 324 (2007) 13–25www.elsevier.com/locate/jimResearch paperAlpaca (Lamapacos)as a convenient source of recombinant camelidheavy chain antibodies (VHHs)David R. Maassa, Jorge Sepulvedac, Anton Pernthanerb, Charles B. Shoemakerc,⁎cSchool of Biological Sciences, Victoria University, Wellington, New ZealandHopkirk Research Institute, AgResearch Grasslands, Palmerston North, New ZealandDepartment of Biomedical Sciences, Tufts Cummings School of Veterinary Medicine, North Grafton, MA, 01536, United StatesbaReceived 23 February 2007; received in revised form 11 April 2007; accepted 18 April 2007Available online 15 May 2007AbstractRecombinant single domain antibody fragments (VHHs) that derive from the unusual camelid heavy chain only IgG class(HCAbs) have many favourable properties compared with single-chain antibodies prepared from conventional IgG. As a result, VHHshave become widely used as binding reagents and are beginning to show potential as therapeutic agents. To date, the source of VHHgenetic material has been camels and llamas despite their large size and limited availability. Here we demonstrate that the smaller,more tractable and widely available alpaca is an excellent source of VHH coding DNA. Alpaca sera IgG consists of about 50%HCAbs, mostly of the short-hinge variety. Sequencing of DNA encoding more than 50 random VHH and hinge domains permitted thedesign of PCR primers that will amplify virtually all alpaca VHH coding DNAs for phage display library construction. Alpacas wereimmunized with ovine tumour necrosis factorα(TNFα) and a VHH phage display library was prepared from a lymph node that drainsthe sites of immunizations and successfully employed in the isolation of VHHs that bind and neutralize ovine TNFα.© 2007 Elsevier B.V. All rights reserved.Keywords:Recombinant antibody; VHH; HCAb; Camelid; Alpaca; TNF1. IntroductionThe existence in camelids of functional heavy chainIgGs (HCAb) that are devoid of light chains was firstdemonstrated byHamers-Casterman et al. (1993).Thisclass of IgG, recently reviewed byDe Genst et al. (2006),is fully able to bind to antigens despite the absence of aAbbreviations:VHH; single-domain antibody fragment; HCAb;heavy chain only antibody; TNF; tumour necrosis factor; PBL;peripheral blood lymphocytes; PCR; polymerase chain reaction; CFU;colony forming unit; HRP; horseradish peroxidase; Ig; immunoglob-ulin; RACE; rapid amplification of cDNA ends.⁎Corresponding author.E-mail address:charles.shoemaker@tufts.edu(C.B. Shoemaker).0022-1759/$ - see front matter © 2007 Elsevier B.V. All rights reserved.doi:10.1016/j.jim.2007.04.008heavy chain CH1 domain and the inability to combinewith light chains. It is thought that HCAbs arose by theloss of a splice consensus signal in the CH1 exon of anancestral camelid (Nguyenet al., 1999; Woolven et al.,1999)together with compensating amino acid substitu-tions that improved its hydrodynamic properties in theabsence of associated light chain (Hamers-Castermanet al., 1993; Muyldermans et al., 1994; Vu et al., 1997).Asa result of the altered splicing, the amino acid sequencethat joins the VHdomain to the CH2 domain in HCAbs,called the“hinge”region, is unique to this class ofantibodies (Hamers-Castermanet al., 1993).Two distincthinge sequence types are found in camels and llamas,commonly referred to as the short hinge and the long14D.R. Maass et al. / Journal of Immunological Methods 324 (2007) 13–25hinge (Hamers-Castermanet al., 1993; van der Lindenet al., 2000).The VHregion of HCAbs, called VHH, issimilar to conventional VHdomains but has uniquesequence and structural characteristics (Vuet al., 1997;Harmsen et al., 2000; Decanniere et al., 2000).HCAbs are able to bind to antigen targets with bindingproperties that appear equivalent to those achieved byconventional IgG (vander Linden et al., 2000),despite thefact that these antibodies lack the additional antigencontact points normally contributed by light chains. Theantigen combining sites of HCAbs thus involve aminoacids from only a single VHH domain. DNA encodingthis domain can readily be cloned and expressed inmicrobes to yield high levels of soluble protein that retainthe antigen-combining properties of the parent HCAb(ArbabiGhahroudi et al., 1997).In addition to the smallsize of these recombinant VHH binding agents, and theirease of production, several other significant advantageshave been found. For example, VHHs are generally morestable, particularly to heat (vander Linden et al., 1999;Dumoulin et al., 2002),than conventional antibody frag-ments and are often found to have unusual epitope speci-ficities, particularly an improved ability to bind active sitepockets to produce enzyme inhibition (Lauwereyset al.,1998).Because of the many favourable properties of VHHs,they have become widely used in research and arebeginning to show commercial potential (Gibbs,2005).Commonly, VHH coding DNAs are amplified fromcamelid B cell mRNA and a phage library is prepared todisplay the encoded VHHs. VHHs having the desiredantigen binding specificity are then isolated by affinityselection (ArbabiGhahroudi et al., 1997).Some re-searchers have obtained VHH agents with desired spe-cificity from non-immune libraries (Verheesenet al.,2006),but immune libraries lead more directly to VHHswith higher affinities (Nguyenet al., 2001).The source of VHH coding DNA was initially OldWorld camels (ArbabiGhahroudi et al., 1997)althoughthese animals are not particularly tractable or widelyavailable. Llamas, which are New World Camelidae, havealso been successfully used as the genetic source of VHHclones using PCR primers based mostly on sequenceinformation from camels (Harmsenet al., 2000; van derLinden et al., 2000).In a recent paper, the first use ofalpacas, also New World Camelidae, as a source of VHHshas been reported (Rothbaueret al., 2006).This researchteam, which has pioneered the application of camelidVHHs, stated that alpacas“arethe least demanding of allCamelidaeand alpaca immunization is readily availablein most countries”. The oligonucleotide primers used toamplify camelid VHHs are generally based on IgGsequences obtained from camels and thus may not beoptimal for other camelids and result in the omission ofmany VHHs from immune libraries. Here we characterizethe immunoglobulin component of alpaca sera and reportan optimized primer design for PCR amplification ofalpaca VHHs based on a representative sampling ofrandom cDNAs. This report should facilitate the utility ofalpacas as a genetic source of VHHs.2. Materials and methods2.1. Preparation of alpaca lymphocytesAlpacas were purchased locally and maintained inpasture. All animal experiments were approved by theWallaceville Animal Ethics Committee. Blood wasobtained from the jugular vein and collected intoheparinised or serum collection tubes. White blood cellswere isolated from about 10 ml of heparinised blood bycentrifugation and peripheral blood lymphocytes (PBL)were partially purified by separation over HISTOPA-QUE®-1077 (Sigma) using standard procedures andstored in RNAlater (Ambion). Serum was separated bycentrifugation and stored at−20°C until testing.The local lymph node from each animal was removedsurgically under general anaesthesia, induced withsodium thiopentone (20 mg/kg intravenously) andmaintained with halothane (1–3% in oxygen). The pre-scapular lymph node, which drains the sites of immuniza-tions used in these studies, was removed through a smallskin incision and blunt dissection of the fat tissue andmuscle overlaying the lymph node. Bleeding wascontrolled by ligation of the nodal artery and vein. Afterremoval of the node, the edges of the dissected tissue andskin were re-apposed with sutures. Post-surgical careincluded a single subcutaneous application of antibiotics(400 mg procaine penicillin + 400 mg dihydrostreptomy-cin sulphate) and an analgesic (flunixin 2 mg/kg). Theexcised lymph node was cut into 1–2 mm thick slices andeither stored in RNAlater, or immediately subjected to aphenol/chloroform based RNA extraction protocol.2.2. Alpaca serum immunoglobulin characterizationAlpaca serum was resolved by SDS-PAGE andstained for protein or transferred to PVDF membranes.Filters were probed with HRP labelled anti-llama IgG(H + L) (Bethyl) by standard western blotting methods.The lanes of the stained gel were scanned in a Kodak ImageStation 2000RT and the immunoglobulin bands, identifiedby the western blot, were quantified using Kodak 1DImage Analysis software. Serum was fractionated byD.R. Maass et al. / Journal of Immunological Methods 324 (2007) 13–2515differential absorption on Protein A and Protein Gaccording toHamers-Casterman et al. (1993).Briefy,2 ml of alpaca serum was diluted 2 fold with PBS andabsorbed onto 5 ml Protein G Sepharose (Invitrogen).IgG3 was eluted with 0.15 M NaCl, 0.58% acetic acid (pH3.5) after which IgG1 was eluted from the column with0.1 M glycine–HCl pH 2.7. The Protein G unboundfraction was absorbed onto 5 ml Protein A Sepharose(Invitrogen) and the IgG2 fraction eluted with 0.15 MNaCl, 0.58% acetic acid (pH 4.5). All fractions wereneutralized and protein concentration determined usingBCA Assay (Pierce).2.3. Immunogen preparation and characterizationThe full-length coding sequence for ovine tumournecrosis factor alpha (ovTNFα) was amplified bypolymerase chain reaction (PCR) from ovine lympho-cyte cDNA using primers based on known sequence(Nashet al., 1991).The ovTNFα coding DNA wasligated into AB6-7 (described below) in frame with theleader sequence. The recombinant soluble ovTNFα wasexpressed and purified by nickel affinity using standardprocedures essentially as described in Section 2.8 below.The recombinant ovTNFα was shown to have activity inthe bioassay described byFlick and Gifford (1984).2.4. Alpaca immunization and serum analysisTwo adult male alpacas were given four immuniza-tions at two week intervals, each including six 0.2 mlintra-dermal and subcutaneous injections of the immu-nogen in the pre-scapular region. The immunogencontained a total of∼400μgof ovTNFα for each im-munization prepared with 13 mg/ml aluminium hydrox-ide gel (Sigma) as an adjuvant. Serum samples wereobtained in weekly intervals and tested for TNFα-specificantibody response by ELISA. Alpaca antibody bound toovTNFα was detected in the ELISA using antisera from arabbit immunized with alpaca immunoglobulins (Greenet al., 1996).Some serum samples were assayed for TNFαneutralizing activity in a standard bioassay (FlickandGifford, 1984)which measures a reduction in TNFαcytotoxicity. Briefly, 100μl/wellof murine fibroblastL929 cells were seeded in 96-well plates at 1 × 105cells/ml and incubated overnight. Dilutions of the serum orpurified VHH were prepared in RPMI and incubatedwith serial twofold dilutions of ovine TNF for 30 min.After removing of the supernatants of the cultured L929cells, 100μlof the prepared dilutions containingactinomycin D at a final concentration of 1.0μg/mlwere added to the wells. Then the plates were incubatedat 37 °C for 24 h, the supernatants were removed and0.5% crystal violet in methanol was added andincubated at room temperature for 10 min. Plates wererinsed gently with water, and the optical density (OD) ofbound dye was determined at 620 nm.2.5. Vector construction and bacterial strainsThe phagemid vector HQ2-2 (Maass et al., IJP, inpress) was used for preparation of gene III phage displaylibraries. This vector derives from pCANTAB5E (GEHealthcare) with additional cloning sites inserted and anM13 gene III leader sequence. The E-tag peptide codingDNA and an amber codon are present, in frame, at thefusion between the displayed protein and gene III. Toexpress larger amounts of soluble VHH, the coding DNAswere introduced into the expression vector, AB6-7. Thisvector is slightly modified from the arabinose promotervector, pBAD18 (Guzmanet al., 1995),to add additionalcloning sites, to use theEscherichia coliompF leader, andto fuse inserted DNA with a carboxyl terminal E-tag andhexahistidine coding DNA. Phagemid vector containingheavy chain cDNAwas transformed intoE. coliTG1 cells(Stratagene). Soluble expression was prepared inE. coliRosseta-gami cells (Novagen) (see below).2.6. Alpaca cDNA preparation and VHH cloningRNAlater was removed from PBL and lymph nodetissue (prepared as above) prior to RNA extraction. TotalRNA was separately isolated from PBL and∼25mg oflymph node tissue using TRI REAGENT®LS (MolecularResearch Center, Inc.) according to the manufacturer'sprotocol. RNA was column-purified using an RNeasyMini Kit according to the guidelines of the manufacturer(Qiagen) and the yield was calculated in a spectropho-tometer at 260 and 280 nm. RNA was stored at−80°C.First-strand cDNA synthesis was performed using Super-Script™II RNAse H−reverse transcriptase (InVitrogen)and poly(A) oligo(dT)12–18 primer to reverse transcribeup to 5μgof total RNA according to the manufacture'sprotocol. cDNA was stored at−20°C until used for PCR.Two oligonucleotides (AL.CH2, ATGGAGAG-GACGTCCTTGGGT and AL.CH2.2 TTCGGGGGG-AAGAYRAAGAC) were designed to universally primereverse transcription of mammalian immunoglobulinmRNA templates at conserved sequence motifs represent-ing the codons that encode amino acids 11 to 15.2 and 4 to10 (IMGT numbering system), respectively, within theCH2 domains (Lefrancet al., 2005).Reverse transcriptionof alpaca mRNA was performed with the CH2 primers as16D.R. Maass et al. / Journal of Immunological Methods 324 (2007) 13–25indicated by the manufacturer for preparing 5′-RACE-Ready cDNA (Clontech). VHand VHH cDNAs were thenamplified by 5′-RACE using the SMART™ RACEcDNA Amplification kit (Clontech) using the CH2primers. The two-band product representing VH-CH1-hinge and VHH-hinge coding sequences was separated byelectrophoresis and the lower band (VHH) was clonedinto the pCR®2.1-TOPO® vector with the TOPO TACloning® Kit (INVITROGEN). Sequencing was per-formed with the T7 primer.To prepare VHH phage display libraries, cDNA wasfirst synthesised by reverse transcription from alpacalymph node RNA using a combination of oligo-dT and pd(N)6primers. Superscript II reverse transcriptase (Invitro-gen) was incubated with total RNA templates according tothe manufacture's protocol. VHH coding DNA for ourearly libraries, including the library used to identify anti-ovTNFα VHHs, was amplified from alpaca cDNA usingtwo primer pairs based on those successfully used on llamacDNA (VH1BACK with Lam07 or Lam08 (Harmsenet al., 2000)).The appropriate PCR products corres-ponding to the VHH were purified via agarose electro-phoresis using QIAquick Gel Extraction kit (Qiagen)PCR products were further amplified with primershomologous to the 5′ ends of the amplified DNA fromthe first PCR, and that introduced appropriate restrictionsites for cloning into our phage display vector. Later ouralpaca VHH libraries employed primer designs based onsequences of random alpaca VHH cDNAs (see Resultsand discussion). The primers used were: AlpVh-L(GGTGGTCCTGGCTGC); AlpVh-F1 (GATCGCCGGC-CAGKTGCAGCTCGTGGAGTCNGGNGG); AlpVHH-R1 (GATCACTAGTGGGGTCTTCGCTGTGGTGCG)which primes within the short hinge coding region at thesame site as Lam07; and AlpVHH-R2 (GATCACTAG-TTTGTGGTTTTGGTGTCTTGGG) which primes withinthe long hinge coding region at the same site as Lam08.Amplified VHH DNA was digested with appropriaterestriction enzymes and ligated into similarly digestedHQ2-2 DNA. The ligated DNA was transfected byelectroporation into high efficiency electroporation-competent TG1 cells (Stratagene) following the recom-mendation of the supplier. Transformants were scrapedoff the plates and recombinant phage produced accord-ing to standard methods (Liand Aitken, 2004).The totalnumber of independent clones present in the library usedin this study was 3 × 107. A quality check was made foreach library in which about 40 random clones werepicked and PCR amplification was performed usingprimers flanking the VHH cloning site. An aliquot ofeach PCR product was analyzed for size by agarose gelelectrophoresis. Another aliquot was digested withBstN1 libraries and the“fingerprint”fragment patternsassessed by agarose gel electrophoresis. In libraries usedin this study,N95%of the clones had inserts and each ofthe clones analyzed had unique BstN1 fingerprints(Tomlinsonet al., 1992).2.7. Screening and selection of phage antibodiesSelection was carried out by“panning”of VHH-displayed phage libraries for phage that bind to immu-notubes (Nunc) coated overnight at 4 °C with 5μg/mlsoluble ovTNF. The tubes were then washed three timeswith PBS, and blocked with 4% non-fat dried milk inPBS (MPBS) at 37 °C for 2 h. A 4 ml suspension ofphage in MPBS was prepared containing 5.0 × 1011CFUwas incubated in an immunotube at room temperature for30 min with continuous rotation, and then for a further90 min without rotation. The tubes were washed 20 timeswith PBS containing 0.1% Tween 20 (PBST) followedby 20 times with PBS. Bound phage were eluted bycontinuous rotation with 1 ml of 100 mM triethanola-mine (Sigma) for 10 min, then, recovered and neutralizedwith 0.2 ml of 1 M Tris–HCl, pH 4.5. A 0.75 ml aliquotof the eluted phage was used to infect 10 ml culture oflog-phaseE. coliTG1 cells. A small aliquot of theinfected bacteria was used in serial dilutions to titrate thenumber of phage eluted while the remainder was pro-cessed as described above to amplify the phagemid forfurther selection or analysis. The binding of selectedVHHs encoded by phagemid clones to ovTNFα wastested by phage ELISA using anti-M13 antibody (GEHealthcare) for detection. Positive clones were“finger-printed” by analysis of their BstN1 digestion patterns(Tomlinsonet al., 1992).2.8. Production of soluble single domain antibodiesThe VHH coding DNA was subcloned into theexpression vector AB6-7 using the same restriction sitesas in the HQ2-2 cloning.E. coliRosetta-gami contain-ing the VHH expression plasmid were grown to anoptical density of 0.5 at 600 nm and then overnight in0.1% arabinose at 28 °C. Soluble protein was purifiedfrom sonicated cells and the recombinant VHH waspurified by nickel affinity using Ni-NTA (Qiagen) asrecommended by the manufacturer. Protein eluting in0.2 M imidazole was dialyzed against PBS. Purity of therecombinant VHH was assessed by Coomassie Bluestaining of SDS-PAGE and protein concentrationdetermined by BCA (Pierce). Western blot and ELISAdetection of recombinant VHH was done using HRPanti-E-tag antibodies (GE Healthcare).D.R. Maass et al. / Journal of Immunological Methods 324 (2007) 13–25172.9. Competitive ELISANunc Maxisorb plates were coated overnight at 4 °Cwith 5μg/mlsoluble ovTNFα in PBS, and then blockedwith 4% MPBS. After washing three times with PBS,serially diluted soluble VHH antibodies were added andincubated at room temperature for 90 min to determinesaturation curves. To detect bound VHH, an anti-E-Tag/HRP antibody (Amersham) was added at 1:8000 dilutionin 4% MPBS for 90 min at room temperature. The wellswere washed and developed with 3,3′,5,5′-tetramethylbenzidine (Applichem). Competitive ELISA was per-formed by preparing plates as described above and then asaturating amount of soluble expressed VHH was addedand incubated for 60 min at room temperature. PBS wasadded to control wells containing no expressed solubleprotein. Serial dilutions of bacterial supernatants contain-ing VHH-displaying phage were added for 90 min atroom temperature. Plates were then washed three timeswith PBST and three times with PBS. To detect boundphage, an anti-M13/HRP antibody (GE Healthcare) wasadded at 1:8000 dilution in 4% MPBS for 90 min at roomtemperature. The wells were washed and developed asdescribed above. Percent binding was calculated as theODtest/ ODcontrol× 100.2.10. Additive ELISAAdditive ELISA was based on the method ofFriguetet al. (1983).Plates were prepared as described aboveand the dilution of each VHH that able to saturate thecoated antigen as determined above was added individ-ually and in pairs. After incubation and washing asdescribed previously, bound antibody was detected bythe addition of anti-E-tag/HRP antibody diluted at1:8000. The additivity index (A.I.) was determined byA.I. = (2A1 + 2/A1+A2−1) × 100 whereA1,A2andA1 + 2are the absorptions reached, in the ELISA, with the firstVHH alone, the second VHH alone and the two VHHstogether (Friguetet al., 1983).3. Results3.1. Alpaca serum immunoglobulinsFig. 1Ashows protein staining of alpaca serum,resolved by SDS-PAGE, from two different alpacas.Fig. 1Bshows a western blot of the alpaca serumproteins recognized by llama anti-IgG (H + L) antibodies(Bethyl). As has been previously observed for othercamelids (Hamers-Castermanet al., 1993; van derFig. 1. Characterization of alpaca serum immunoglobulins. A. Coomassie blue stained gel following SDS-PAGE of serum from two different normalalpacas under reducing conditions. MW markers are shown (M) and their sizes indicated. B. Western blot of the alpaca serum resolved in A andprobed with anti-llama IgG (H + L). The identities of the stained proteins are indicated. C and D. Coomassie blue stained gel following SDS-PAGE ofthree purified alpaca IgG isotypes resolved under non-reducing (panel C; 7.5% gel) and reducing conditions (panel D; 10% gel). [ Pobierz całość w formacie PDF ]